Review



snail cdna  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    OriGene snail cdna
    Snail Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nm+005985+human+cdna/10__1158_slash_0008___5472__can___19___0442-68-16-21?v=OriGene
    Average 90 stars, based on 4 article reviews
    snail cdna - by Bioz Stars, 2026-07
    90/100 stars

    Images



    Similar Products

    snail cdna  (OriGene)
    90
    OriGene snail cdna
    Snail Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nm+005985+human+cdna/10__1158_slash_0008___5472__can___19___0442-68-16-21?v=OriGene
    Average 90 stars, based on 1 article reviews
    snail cdna - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    nm 005985 human cdna  (OriGene)
    90
    OriGene nm 005985 human cdna
    Nm 005985 Human Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nm+005985+human+cdna/pmc05705820-406-3-9?v=OriGene
    Average 90 stars, based on 1 article reviews
    nm 005985 human cdna - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    d e rev ttcctctgtgcgccgctctctcccaggacaggcac 534 snai1 nm 005985 human cdna  (OriGene)
    90
    OriGene d e rev ttcctctgtgcgccgctctctcccaggacaggcac 534 snai1 nm 005985 human cdna
    D E Rev Ttcctctgtgcgccgctctctcccaggacaggcac 534 Snai1 Nm 005985 Human Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nm+005985+human+cdna/10__1128_slash_mcb__00328___17-165-127-137?v=OriGene
    Average 90 stars, based on 1 article reviews
    d e rev ttcctctgtgcgccgctctctcccaggacaggcac 534 snai1 nm 005985 human cdna - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    snail cdna plasmids  (OriGene)
    90
    OriGene snail cdna plasmids
    <t>MiR-137</t> and miR-34a modulate EMT, invasion and sphere-forming ability of OC cells through targeting Snail. MiR-137 or miR-34a inhibitor or Neg inhibitor was co-transfected into SKOV-3 cells, together with (or without) Snail siRNA. MiR-137 or miR-34a mimic or Neg mimic was co-transfected into ES-2 cells, together with (or without) Snail <t>cDNA</t> vector lacking the 3′-UTR region. Cell invasion assay ( a ), sphere formation assay ( b ) and Western blotting analysis of indicated proteins ( c ) in OC cells treated as described above were performed. ** P < 0.01
    Snail Cdna Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nm+005985+human+cdna/pmc05011787-23-18-21?v=OriGene
    Average 90 stars, based on 1 article reviews
    snail cdna plasmids - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    MiR-137 and miR-34a modulate EMT, invasion and sphere-forming ability of OC cells through targeting Snail. MiR-137 or miR-34a inhibitor or Neg inhibitor was co-transfected into SKOV-3 cells, together with (or without) Snail siRNA. MiR-137 or miR-34a mimic or Neg mimic was co-transfected into ES-2 cells, together with (or without) Snail cDNA vector lacking the 3′-UTR region. Cell invasion assay ( a ), sphere formation assay ( b ) and Western blotting analysis of indicated proteins ( c ) in OC cells treated as described above were performed. ** P < 0.01

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: MiR-137 and miR-34a directly target Snail and inhibit EMT, invasion and sphere-forming ability of ovarian cancer cells

    doi: 10.1186/s13046-016-0415-y

    Figure Lengend Snippet: MiR-137 and miR-34a modulate EMT, invasion and sphere-forming ability of OC cells through targeting Snail. MiR-137 or miR-34a inhibitor or Neg inhibitor was co-transfected into SKOV-3 cells, together with (or without) Snail siRNA. MiR-137 or miR-34a mimic or Neg mimic was co-transfected into ES-2 cells, together with (or without) Snail cDNA vector lacking the 3′-UTR region. Cell invasion assay ( a ), sphere formation assay ( b ) and Western blotting analysis of indicated proteins ( c ) in OC cells treated as described above were performed. ** P < 0.01

    Article Snippet: MiRNA mimic and miRNA inhibitor for miR-137 or miR-34a (30 nM, Ambion), Snail siRNA (5 nM, Ambion) and Snail cDNA plasmids (OriGene) were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol.

    Techniques: Transfection, Plasmid Preparation, Invasion Assay, Tube Formation Assay, Western Blot